Overview I’ve been wondering about the differences between proteins and enzymes, and thought it would be good to start from first principles. In this post, I wanted to talk broadly about how proteins are made from DNA. Amino acids DNA is made of strings like GCCCGTAATAGTACATTACGA; This is translated in triplets into amino acids, and groups of amino acids produce proteins. So, if we grouped this into triplets, it would look like: (GCC)(CGT)(AAT)(AGT)(ACA)(TTA)(CGA).
